Sekwencjonowanie DNA: Różnice pomiędzy wersjami

Dodane 160 bajtów ,  11 lat temu
m
m (robot dodaje: id:Sekuensing asam nukleat)
[[GrafikaPlik:Sanger-DNA-seq.png|thumb|right|Zasada sekwencjonowania DNA metodą Sangera: <br /> '''A.''' – przykładowa sekwencja DNA <br /> '''B.''' – przyłączenie startowego [[oligonukleotydOligonukleotydy|oligonukleotydu]]u do nici matrycowej i kierunek syntezy DNA <br /> '''C.''' - produkty syntezy DNA, zakończone [[fluorescencja|fluorescencyjnie]] znakowanymi dideoksynukleotydami (kolorowe litery) <br> />'''D.''' – [[Chromatogram]] rozdziału fragmentów w [[elektroforeza|elektroforezie kapilarnej]]. ]]
 
'''Sekwencjonowanie DNA''' – technika odczytywania [[sekwencja|sekwencji]], czyli kolejności [[para zasad|par nukleotydowych]] w cząsteczce [[Kwas deoksyrybonukleinowy|DNA]].
 
Sekwencjonowanie dokonuje się przy pomocy zautomatyzowanych sekwencjonatorów. Manualne sekwencjonowanie stosuje się przy opracowywaniu nowatorskich metod, w niektórych laboratoriach dla krótkich fragmentów, lub podczas ćwiczeń {{fakt|data=2010-03}}.
 
* Przykład sekwencji DNA (początek operonu laktozowege [[EscherichiaPałeczka coliokrężnicy|''E. coli'']] z [[GenBank]]) :
GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGG
: gdzie: A – [[adenina]]; C – [[cytozyna]]; G – [[guanina]]; T – [[tymina]]
 
=== Metody historyczne ===
Historyczną już i wypieraną metodą jest opracowana w [[1981]]<ref> {{cytuj książkę |nazwisko=Passarge |imię=Eberhard |autor |tytuł=Genetyka - Ilustrowany przewodnik |wydawca=Wydawnictwa Lekarskie PZWL |miejsce=Warszawa |rok=2004 |strony=52 |isbn=83-200-2908-2 }} </ref>- r [[metoda Sangera]], oparta o syntezę DNA przez [[polimerazaPolimerazy|polimerazę DNA]] ''[[in vitro]]''. Do reakcji dodaje się niewielką ilość trifosforanów dideoksynukleotydów ([[ddNTP]]), które są wbudowywane w DNA, ale ich dołączenie uniemożliwia dalsze wydłużanie nici. W ten sposób otrzymuje się fragmenty DNA o różnej długości zakończone specyficznym [[nukleotydNukleotydy|nukleotydem]]em. Produkty reakcji rozdziela się [[elektroforeza|elektroforetycznie]], co powoduję ich segregację pod względem wielkości.
 
=== Metody współczesne ===
Obecnie metoda odczytu została zautomatyzowana dzięki wykorzystaniu znakowanych [[fluorescencja|fluorescencyjnie]] trifosforanów dideoksynukleotydów i pozwala na odczyt 300-1000 par zasad z jednej [[kapilara|kapilary]] lub linii na [[żel]]u{{fakt|data=2010-03}}.
 
Autorem alternatywnej metody sekwencjonowania DNA, z wykorzystaniem specyficznej, chemicznej degradacji DNA, byli [[Walter Gilbert]] i [[Allan Maxam]] (metoda Maxama-Gilberta)<ref>[http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=265521 A M Maxam and W Gilbert, ''A new method for sequencing DNA'', Proc Natl Acad Sci U S A. 1977 February; 74(2): 560–564.]</ref>. Gilbert wraz z [[Frederick Sanger|Frederickiem Sangerem]] otrzymali za to osiągnięcie [[Nagroda Nobla|nagrodę Nobla w dziedzinie chemii]]. Metoda Maxama-Gilberta obecnie jest rzadko stosowana.
 
Nowoczesne masowo równoległe aparaty do sekwencjonowania DNA są w stanie pracować z szybkością rzędu milionów [[para zasad|par zasad]] na godzinę{{fakt|data=2010-03}}. [[tranzystor polowy DNA|Tranzystory polowe DNA]] umożliwiają użycie natywnego DNA w hybrydyzacji do [[mikromacierz|mikromacierzy]]y i odczyt w czasie rzeczywistym.
 
Nagroda [[X Prize Foundation|X prize]] w wysokości 10 mln dolarów czeka na ośrodek, który będzie w stanie zsekwencjonować 100 [[genom]]ów ludzkich w ciągu 10 dni<ref>[http://genomics.xprize.org/newsevents/press_releases_2006-10-04_Archon_X_PRIZE_for_Genomics.html ogłoszenie o konkursie X Prize Foundation]</ref>. Pierwsze sekwencjonowanie genomu człowieka zajęło wiele lat (zob. [[Projekt poznania ludzkiego genomu]]).
 
=== Metody rozwojowe ===
* [[Reakcja łańcuchowa polimerazy|PCR]]
*[[PCR]]
* Metodą bąbelkową + pyrosekwencjonowanie
** 454 sequencing pozwala 300 MBp na dzień w jednej maszynie [http://en.wikipedia.org/wiki/454_Life_Sciences]. Metoda ta jest szczególnie przydatna do sekwencjonowania aDNA.
 
* bezpośredniego odczytu{{fakt|data=2010-03}}:
** nanosekwencjonowanie. Przesuwająca się cząsteczka DNA poprzez centrum aktywne modyfikowanych polimeraz jest odczytywana bezpośrednio. Szybkość takiego odczytu może dochodzić od 300 Bp/s dla pojedynczego nanometrowego czujnika<ref>http://visigenbio.com/technology_overview.html</ref>.
** mikroskopowe
 
== Historia rozwoju metod sekwencjonowania DNA ==
* [[1953]] - opracowanie modelu [[Podwójna helisa|podwójnej helisy]] DNA przez [[James D. Watson|Jamesa Watsona]] i [[Francis Crick|Francisa Cricka]]
* [[1972]] - opracowanie sposobów izolacji materiału do dalszych badań. Rozwój technologii rekombinacji umożliwiający izolację dowolnych fragmentów DNA i ich replikację.
* [[1977]] - Allan Maxam i Walter Gilbert ogłaszają publikację pt.: ''Sekwencjonowanie DNA przez chemiczną degradację''. W tym samym czasie Sanger opublikował też metodę sekwencjonowania DNA przez syntezę katalizowaną [[enzymEnzymy|enzymatycznie]]atycznie.
* [[1980]] - Fred Sanger i Walter Gilbert otrzymali Nagrodęnagrodę Nobla.
* [[1982]] - utworzono [[GenBank|Genbank]] - publicznie dostępną bazę danych sekwencji DNA
** [[Andre Marion]] i [[Samuel Eletr]] utworzyli firmę ''[[Applied Biosystems]]'', która w tym okresie zdominowała automatyczne sekwencjonowanie DNA
* [[1982]] - [[Akiyoshi Wada]] zbudował roboty sekwencyjne dla firmy [[Hitachi (firma)|Hitachi]].
* [[1984]] - badacze z [[MRC]] odczytali kompletną sekwencję [[Wirus Epsteina-Barr|wirusa Epstein-Barr]], 170 kb.
* [[1997]] - zsekwencjonowano 5Mb genom bakterii ''[[Pałeczka okrężnicy|Escherichia coli]]''.
* [[2001]], [[15 lutego]] - Konsorcjum [[Projekt poznania ludzkiego genomu |HUGO]] opublikowało sekwencję genomu ludzkiego w ''[[Nature]]''.
* [[2001]], [[16 lutego]] - firma [[Celera Genomics]] opublikowała sekwencję genomu ludzkiego w ''[[Science]]''.
 
{{Przypisy}}
 
 
 
{{przypisy}}
 
[[Kategoria:DNA]]