Sekwencjonowanie DNA: Różnice pomiędzy wersjami

m
lit., wikizacja
(→‎Metody współczesne: +Projekt Genograficzny +genetyka genealogiczna +tanie nowoczesne metody sekwencjonowania DNA, +poprawa linków)
m (lit., wikizacja)
Sekwencjonowanie dokonuje się przy pomocy zautomatyzowanych sekwencjonatorów. Manualne sekwencjonowanie stosuje się przy opracowywaniu nowatorskich metod, w niektórych laboratoriach dla krótkich fragmentów, lub podczas ćwiczeń{{fakt|data=2010-03}}.
 
* Przykład sekwencji DNA (początek [[operon (biologia)|operonu]] laktozowegelaktozowego [[Pałeczka okrężnicy|''E. coli'']] z [[GenBank]]):
GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGG
: gdzie: A – [[adenina]]; C – [[cytozyna]]; G – [[guanina]]; T – [[tymina]]